Inactive p53 Mutants May Enhance the Transcriptional Activity of Wild-Type p53

Wei Zhang, Jerry W. Shay, Albeit Deisseroth

Research output: Contribution to journalArticlepeer-review

31 Scopus citations

Abstract

The p53 mutants 248Trp, 175His. and 281Gly fail to activate transcrip tion mediated by p53CON element (GGACATGCCCGGGCATGTCC) or the ribosomal gene cluster element (ACGTTTGCCTTGCCTGGACTTGCCTGGCCTTGCCTT). We studied the effect of these inactive p53 mutants on the transcriptional activity of wild-type p53 by cotransfection of both wild-type and mutant p53 expression vectors into p53-null K562 chronic myelogenous leukemia cells. The p53 mutants enhanced the p53CON-mediated gene expression of wild-type p53 but decreased the wild-type p53-activated transcription mediated by ribosomal gene cluster. Thus, p53CON and ribosomal gene cluster represent distinct p53-binding elements. Furthermore, p53 mutants may affect the transcriptional activ ity of wild-type p53 in either a dominant positive or a dominant negative manner, depending on the binding element present.

Original languageEnglish (US)
Pages (from-to)4772-4775
Number of pages4
JournalCancer Research
Volume53
Issue number20
StatePublished - Oct 1993

ASJC Scopus subject areas

  • Oncology
  • Cancer Research

Fingerprint

Dive into the research topics of 'Inactive p53 Mutants May Enhance the Transcriptional Activity of Wild-Type p53'. Together they form a unique fingerprint.

Cite this